morrisjohn@frodo.mgh.harvard.edu
August, 1994
setenv ACEDB `pwd` bin/taceAlternatively, enter the full path name to the parent directory of wspec and start the database. Something similar to:
setenv ACEDB /usr/home/acedb bin/taceAfter the opening lines of the database description scroll by you will be presented with the tace prompt:
acedb >Typing ? and return, provides a list of command options as follows.
Quit : Exits the program. Any command abbreviates, $starts a
subshell, until empty line.
Help : for further help.
Classes : Give a list of all the visible class names and how many
objects they contain.
Find class [name]: New current list with all objects from class,
optionally matching name.
Model class: Shows the model of the given class, useful before
Follow or Where commands.
Grep template: searches for *template* everywhere in the database.
Undo : returns the current list to its previous state.
List [template]: lists names of items in current list [matching
template].
Show [name] : shows objects of current list matching name or all.
Is template : keeps in list only those objects whose name match the
template.
Remove template : removes from list those objects whose name match
the template.
Follow Tag : i.e. Tag Author gives the authors of the papers of the
current list.
Where query_string : performs a complex query - 'help query_syntax'
for further info.
Write filename : acedump current list to file.
Biblio : shows the associated bibliography.
Dna : Fasta dump of related sequences.
Array class:name format : formatted acedump of A class object.
Parse file : parses an aceFile, or stdio, until
Table-Maker file outputfile : Executes a table-maker.def command
file, outputs
Read-models
acedb > C
These are the known classes and the number of objects in each class
KeySet 1
Model 40
Action 0
Image 235
Author 4867
Laboratory 0
Journal 377
Paper 3917
Library 0
Mutagen 51
Method 8
Sequence 16008
Restriction 0
Map 31
Gene_Class 244
Species 0
Allele 1186
Strain 0
Interval 0
2_point_data 3741
Multi_pt_data 0
Df_Dup_data 0
Clone 19136
Clone_Grid 6
Pool 0
ABI 0
Locus 1488
MultiMap 5
YAC 0
Fragment 0
Chrom_Band 0
Motif 343
Enzyme 0
GDB_id 0
OMIM 0
Probe 527
Reference 0
Homology 0
Peptide 0
Source 59
Contact 1315
Cross 0
Segregation 256
Gene_Product 687
Map_population 26
Qualifier 0
Gene 0
DNA_Resource 2869
Germplasm_Resource 7299
Lab_Location 0
Match 0
Interval_ends 0
Multi_counts 0
Balancer 0
map_location 0
map_error 0
acedb > help
Commands are not case sensitive and can be abbreviated. Lines
starting with @ will take the next word as a file name to read
commands from (include file), passing subsequent words on the line as
parameters. Lines starting with $ execute the remainder of the line
in an interactive subshell.
Everything following // on a line is ignored (comment).
To escape any of these special characters use a backslash, eg \\@.
This program maintains an internal list of current objects.
You can List or Show or Write the content of the list.
You can change the list with the simple commands:
Grep, Find, Is, Follow, Biblio.
Perform complex queries with:
Where search-string', where 'search-string' follows the acedb
query syntax.
Print relational tables with Table table-command-file
To see a list of all possible commands type ?.
For further help on any of the following features type 'help feature'
Tacedb : copyright etc
Query_syntax for the find command
Useful_sequences : SL1 etc
Clone_types used in the physical map (vector etc)
DNA_and_amino_acids_nomenclature : codes for bases/amino acids and
translation table
acedb > find author morris acedb > acedb > find author morris* Found 6 objects in this class acedb > list KeySet : Answer_3 Author : "Morris, A." Author : "Morris, P. C." Author : "Morris, P. F." Author : "Morris, Paul Francis" Author : "Morris, R. O." Author : "Morrison, A." acedb > find contact *george* Found 8 objects in this class acedb > list KeySet : Answer_1 Contact : "Coupland, George" Contact : "Haughn, George" Contact : "Jen, George" Contact : "Karlin-Neumann, George" Contact : "Mourad, George" Contact : "Murphy, George J.P." Contact : "Picard, George" Contact : "Redei, George P."
acedb > model author
?Author
Paper ?Paper XREF Author
acedb > model contact
?Contact
Profession Text
Address Mail Text
Institution Text
Address1 Text
Address2 Text
Address3 Text
Address4 Text
Address5 Text
City Text
State Text
Region Text
PostalCode Text
Country Text
Phone Text
E_mail Text
Bitnet Text
Internet Text
Fax Text
Telex Text
Research_interest ?Text
Keyword ?Keyword
Publishes_as ?Author XREF Full_name
Associate ?Contact XREF Associate
Member_of_lab ?Contact XREF Member_of_lab
Last_update Text
Obtained_from ?Source
Hint ?LongText
acedb > grep pyrophosphorylase I search for texts or object names matching *pyrophosphorylase* Found 35 objects acedb > list KeySet : Answer_2 Phenotype : "General-3" Phenotype : "Greenbook-10" Phenotype : "New-130" Phenotype : "New-131" Phenotype : "New-132" Phenotype : "New-133" Phenotype : "New-134" Phenotype : "New-367" Sequence : "ATRNAAPL1" Sequence : "ATRNAAPL2" Sequence : "ATRNAAPL3" Sequence : "ATRNAAPS" Sequence : "GenPept:VFAGPC_1" Sequence : "GenPept:VFAGPP_1" Sequence : "PIR:S12038" Sequence : "PIR:S13380" Sequence : "SwissProt:GALU_ECOLI" Sequence : "SwissProt:GLG1_ORYSA" Sequence : "SwissProt:GLG1_SOLTU" Sequence : "SwissProt:GLG1_WHEAT" Sequence : "SwissProt:GLG2_HORVU" Sequence : "SwissProt:GLG2_SOLTU" Sequence : "SwissProt:GLG2_WHEAT" Sequence : "SwissProt:GLGS_WHEAT" Sequence : "SwissProt:RFBM_SALTY" Paper : "komed-1988-aadbz" Paper : "li----1992-aahfx" Paper : "lin---1987-aabri" Paper : "lin---1988-aaavt" Paper : "lin---1988-aadau" Paper : "lin---1988-aadcr" Paper : "neuha-1990-aadlh" Paper : "preis-1987-aabqj" Paper : "stark-1992-aahet" Paper : "villa-1993-aahqk" acedb >
acedb > grep pyro I search for texts or object names matching *pyro* Found 111 objects acedb > is toto 0 objects kept acedb > undo Recovered 111 objects
acedb > find clone 112* Found 91 objects in this class acedb > list 1129* KeySet : Answer_3 Clone : "1129%" Clone : "11290" Clone : "11291" Clone : "11292" Clone : "11293" Clone : "11294%" Clone : "11296" Clone : "11297" Clone : "11298" Clone : "11299"
acedb > find clone 11290
Found 1 objects in this class
acedb > show
Clone : "11290"
11290
FingerPrint Gel_Number 262
Approximate_Match_to 11568
Bands 116980 21
acedb > find clone 112* Found 91 objects in this class acedb > is 1129* 10 objects kept acedb > is *6* 1 objects kept acedb > list KeySet : Answer_6 Clone : "11296"
acedb > find locus em* Found 175 objects in this class acedb > remove emb* 1 objects kept
acedb > find clone Found 19136 objects in this class acedb > follow locus Autocompleting locus to Locus Found 119 objects acedb > follow sequence Autocompleting sequence to Sequence Found 11 objects acedb > list KeySet : Answer_8 Sequence : "ATABI3" Sequence : "ATHADH" Sequence : "ATHCHS" Sequence : "ATHCPGAPBA" Sequence : "ATHGAPBB" Sequence : "ATNR2R" Sequence : "ATU22" Sequence : "ATU23" Sequence : "ATU24" Sequence : "ATU25" Sequence : "ATU29"
acedb > Find Author Found 4862 objects acedb > Where COUNT paper > 50 Found 10 objects acedb > find paper Found 3916 objects in this class acedb > where Year >= 1992 AND Keyword = stress* Found 5 objects acedb > list KeySet : Answer_3 Paper : "coghl-1992-aagba" Paper : "lang--1992-aagdi" Paper : "marrs-1993-aahcx" Paper : "oster-1993-aahay" Paper : "takah-1992-aahkc"
acedb > write stress.papers I wrote 5 objects to file stress.papers acedb > write /files/home/stress.papers I wrote 5 objects to file /files/home/stress.papers
acedb > grep dehydrogenase
I search for texts or object names matching *dehydrogenase*
Found 509 objects
acedb > biblio
Associated bibliography
knoop-1991-aadyt :
Trans-splicing integrates an exon of 22 nucleotides into the nad5
mRNA in higher plant mitochondria
Knoop, V., Brennicke, A., Schuster, W., Wissinger, B..
EMBO (European Molecular Biology Organization) Journal 10,
3483-3493 (1991)
brand-1992-aahan :
The nad4L gene is encoded between exon c of nad5 and orf25 in the
Arabidopsis mitochondrial genome.
Knoop, V., Brennicke, A., Brandt, P., Sunkel, S., Unseld, M..
Molecular & General Genetics 236, 33-38 (1992)
chang-1986-aacxn :
Molecular cloning and DNA sequence of the Arabidopsis thaliana
alcohol dehydrogenase gene
Chang, C., Meyerowitz, E. M..
Proceedings of the National Academy of Sciences of the United
States of America 83, 1408-1412 (1986)
....
acedb > find sequence atd*
Found 2 objects in this class
acedb > dna
Option not written yet
acedb > follow DNA
Found 2 objects
acedb > write /tmp/atd.seq
I wrote 2 objects to file /tmp/atd.seq
acedb > $cat /tmp/atd.seq
DNA : "ATDNABFS1"
gaattcttatattaacttttgttccttcagttttatacatatagtcatat
gacattgaaaaaccagcacaaactccttcagttgatcaccaatagaaaca
acaaaatacagtataatattt...
acedb > Array DNA:ATHCOLUMB c ¡ û u Ø ‹ ....This is not a bug, DNA is stored in compressed format.
acedb > parse rawdata/test.ace !! 1 objects read with 0 errors acedb > parse Contact "Joe Thaliana" Institution "Massachusetts General Hospital" PostalCode "02114" Last_update "1-Jan-1990" Contact "James Thaliana" Institution "Massachusetts Institute of Technology" Last_update "1-Jan-1990" [control-d pressed at this point] !! 2 objects read with 0 errors acedb > Please type ? for a list of commands. acedb > $> A bientot
acedb > table wquery/long.seq.def AT2SALBGB 4274 AT3RRNA 4310 ATAAI 4395 ATACCSYNG 5613 ATATPGP1 6300 ATATSGS 9647 ATAUXIN 4966 ....
acedb > Read Watch out ! An erroneous modification of the models may screw up the system. Do you want to proceed? (y or n) y !! 0 objects read with 0 errors New models read, save your work before quitting acedb > Please type ? for a list of commands. acedb > save !! Keyword save does not match Please type ? for a list of commands. acedb > quit $>You did not save your work, should I ? (y or n) y A bientot
The $ starts a subshell and is useful for listing file name and contents. For example listing the contents of the wquery directory when you want to run the Table-maker command, or listing the contents of a command file (see below). Although the "acedb >" prompt does not reappear unless the return key is pressed, the next command is expected to be a tace command unless preceded by the $ character again.
acedb > $ls wquery 2pointData.def findgenes.cmd DfDupData.def g2pmap.def Select_strains.qry gMap-dominant-genes.def allele2clone.def gMap-dominant-alleles.def clones2chromo.def lage1.def coauthors.cmd long.seq.def command.examples.qry map_data.1.def contig.qry multimap.def df_dup_1.def restrict.sites df_dup_2.def sam-bug.def df_dup_4.def sam2.def email1.def table1.def examples.qry table2.def examples2.qry types.qryThe @ character command is used preceding a filename and indicates that tace should execute commands listed in the file. This is useful if you have a set of queries that you perform frequently. Additionally, it is possible to pass parameters to the file in much the same manner as C shell scripts, by appending the parameters after the file name. Note that in the second example below the string "author morris*" is passed as a single parameter because the two words are enclosed within quotes. By default tace appends .cmd to the file name, unless the "." character is part of the filename.
acedb > @script.tace Found 4867 objects in this class acedb > Found 14 objects acedb > KeySet : Answer_1 Author : "Harris, J. I." Author : "Harris, L. M." Author : "Harris, T. J. R." Author : "Heslop Harrison, J. S." .... acedb > @script2.tace "author morris*" paper Found 6 objects in this class acedb > Autocompleting paper to Paper Found 10 objects acedb > KeySet : Answer_2 Paper : "altma-1991-aachi" Paper : "dunn--1993-aahmw" Paper : "halft-1992-aaemw" Paper : "laten-1993-aahor" Paper : "morri-1987-aadyh" Paper : "morri-1988-aaawf" Paper : "morri-1989-aaaux" Paper : "morri-1991-aachz" Paper : "rober-1976-aadze" Paper : "rober-1976-aaeet"Here are the script files, displayed by using the tace "$" character and the unix cat command. Each contain three lines of text.
acedb > $cat script.tace find author where *rris* list acedb > $cat script2.tace find %1 follow %2 listHere is a longer example using script files to update the "Contact" class in a (very small) database and automatically keep track of the files that are read in. Note that tace displays the message "Please type ? for a list of commands." when it encounters a blank line (which is how it interprets the comment lines in the script file). The contents of the files are shown at the bottem of the example.
acedb > find contact Found 5 objects in this class acedb > @update.script newdata.ace Please type ? for a list of commands. acedb > Please type ? for a list of commands. acedb > !! 3 objects read with 0 errors acedb > Please type ? for a list of commands. acedb > find contact Found 8 objects in this class acedb > list KeySet : Answer_3 Contact : "ACEDB Newsgroup" Contact : "Boguski, Mark" Contact : "Buchanan, Barbara" Contact : "Cherry, J. Michael" Contact : "GenBank" Contact : "Morris, John" Contact : "Thierry-Mieg, Jean" Contact : "Tolstoshev, Carolyn" acedb > @update.script olddata.ace Please type ? for a list of commands. acedb > Please type ? for a list of commands. acedb > !! 3 objects read with 0 errors acedb > Please type ? for a list of commands. acedb > find contact Found 5 objects in this class acedb > list KeySet : Answer_4 Contact : "Boguski, Mark" Contact : "Buchanan, Barbara" Contact : "Cherry, J. Michael" Contact : "GenBank" Contact : "Tolstoshev, Carolyn"Here are the contents of the files. As displayed by tace.
acedb > $cat update.script // Update script for tace // Modified Thu Aug 4 08:44:09 EDT 1994 JWM $echo `date` >> update.log $echo -n "Parsing file %1 ... " >> update.log Parse %1 $echo "Done" >> update.log
$cat update.log Thu Aug 4 09:48:36 EDT 1994 Parsing file newdata.ace ... Done Thu Aug 4 09:49:42 EDT 1994 Parsing file olddata.ace ... Done
$cat newdata.ace Contact : "Morris, John" Internet john.morris@frodo.mgh.harvard.edu Contact : "Thierry-Mieg, Jean" Internet mieg@kaa.cnrs-mop.fr Contact : "ACEDB Newsgroup" Internet acedb@net.bio.net
$cat olddata.ace -D Contact : "Morris, John" -D Contact : "Thierry-Mieg, Jean" -D Contact : "ACEDB Newsgroup"
/usr/home/acedb% script
Script started, file is typescript
~% cd /usr/home/acedb
/usr/home/acedb% bin/tace
**** acedb queryserver: Version 3.0 20 November 1993 ****
Authors: Richard Durbin (MRC, UK) rd@mrc-lmb.cam.ac.uk
Jean Thierry-Mieg (CNRS, France) mieg@kaa.cnrs-mop.fr
etc....
acedb > Classes
These are the known classes and the number of objects in each class
KeySet -1
Model 17
LongText 1
Action 0
Laboratory 0
etc ...
acedb > quit [quit tace]
$>
A bientot
/usr/home/acedb% exit [quit the Unix script]
exit
Script done, file is typescript
/usr/home/acedb%
Now edit the "typescript" file to create a tace "dump.script" file
that has a format similar to the following. Don't include Classes
without any entries as the Find commmand will retain the objects in
the current list from the previous Find and they will again be written
out. Exclude the Models class as this may cause you problems if you
read the file back in. Notice at the bottem there is a Unix command
to concatenate all the files into one large file. This can be easier
to handle than many little files.
//tace script to dump database Find LongText Write LongText.dump Find Laboratory Write Laboratory.dump Find Paper Write Paper.dump Find Contact Write Contact.dump . . . Find map_error Write map_error.dump $cat *.dump > database.fulldump.aceWhen you run the dump script you get something like the session below. The contents may be examined in the database.fulldump.ace file.
acedb > @dump.script Found 2 objects in this class acedb > I wrote 2 objects to file LongText.dump acedb > Found 1 objects in this class acedb > I wrote 1 objects to file Laboratory.dump acedb > Found 1 objects in this class acedb > I wrote 1 objects to file Paper.dump acedb > Found 8 objects in this class acedb > I wrote 8 objects to file Contact.dump acedb > . . .// Modified Fri Aug 5 15:56:22 EDT 1994 //jmorris-aatdb